circad | circRNAs associated with diseases

rno_circRNA_013779
Gene	SMEK1	Organism	Rat
Genome Locus	chr6:134274855-134287009:-	Build	n/a
Disease	Neuropathic pain	ICD-10	Hereditary and idiopathic neuropathy (G60)
DBLink	Link to database	PMID	28761373
Experimental Method
Sample Type	Ipsilateral dorsal horn samples	Comparison	control rats and Rats underwent Craniocervical Instability (CCI) surgeries to induce neuropathic pain on the left hind limb.
Method for Estimation	Quantitative PCR and Microarrays	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GTGCGAAGTGCTGCTACTGA Reverse TCTGGTATGCAGTGTTAGGGTT	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Cao, S, Deng, W, Li, Y, Qin, B, Zhang, L, Yu, S, Xie, P, Xiao, Z, Yu, T (2017). Chronic constriction injury of sciatic nerve changes circular RNA expression in rat spinal dorsal horn. J Pain Res, 10:1687-1696.